uu.seUppsala University Publications
Change search
CiteExportLink to record
Permanent link

Direct link
Cite
Citation style
  • apa
  • ieee
  • modern-language-association
  • vancouver
  • Other style
More styles
Language
  • de-DE
  • en-GB
  • en-US
  • fi-FI
  • nn-NO
  • nn-NB
  • sv-SE
  • Other locale
More languages
Output format
  • html
  • text
  • asciidoc
  • rtf
Determination of the solution conformation of a non-uniformly deuterium labelled (Uppsala 'NMR-window') 21mer RNA hairpin by NMR spectroscopy and computational methods.
Uppsala University.
Uppsala University.
Uppsala University.
1997 (English)In: NUCLEOSIDES & NUCLEOTIDES, ISSN 0732-8311, Vol. 16, no 5-6, 743-750 p.Article in journal (Other scientific) Published
Abstract [en]

The conformation of a 21mer RNA hairpin, 5'-r(AGCCCGCCUAAUGAGCGGGCU)-3, was determined by NMR spectroscopy and computer calculations. The 'Uppsala NMR-window' approach was used to overcome the problem of spectral overlap.

Place, publisher, year, edition, pages
MARCEL DEKKER INC , 1997. Vol. 16, no 5-6, 743-750 p.
Keyword [en]
TIME-AVERAGED RESTRAINTS; MOLECULAR-DYNAMICS; H-1-NMR WINDOW; OLIGO-DNA; SIMPLIFY; RESIDUES; PROTONS; DUPLEX; H-1
Identifiers
URN: urn:nbn:se:uu:diva-27445OAI: oai:DiVA.org:uu-27445DiVA: diva2:55340
Note
Addresses: UNIV UPPSALA, CTR BIOMED, DEPT BIOORGAN CHEM, S-75123 UPPSALA, SWEDEN.Available from: 2008-10-17 Created: 2008-10-17 Last updated: 2011-01-15

Open Access in DiVA

No full text

By organisation
Uppsala University

Search outside of DiVA

GoogleGoogle Scholar

urn-nbn

Altmetric score

urn-nbn
Total: 360 hits
CiteExportLink to record
Permanent link

Direct link
Cite
Citation style
  • apa
  • ieee
  • modern-language-association
  • vancouver
  • Other style
More styles
Language
  • de-DE
  • en-GB
  • en-US
  • fi-FI
  • nn-NO
  • nn-NB
  • sv-SE
  • Other locale
More languages
Output format
  • html
  • text
  • asciidoc
  • rtf